Review




Structured Review

Applied Biological Materials Inc target gene knockout
Target Gene Knockout, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/pm42098810-62-7-16?v=Applied+Biological+Materials+Inc
Average 86 stars, based on 1 article reviews
target gene knockout - by Bioz Stars, 2026-07
86/100 stars

Images



Similar Products

86
Applied Biological Materials Inc target gene knockout
Target Gene Knockout, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/pm42098810-62-7-16?v=Applied+Biological+Materials+Inc
Average 86 stars, based on 1 article reviews
target gene knockout - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Synthego Inc gene knockout kit v2 targeting zeb2
Gene Knockout Kit V2 Targeting Zeb2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/pm40215981-707-26-35?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
gene knockout kit v2 targeting zeb2 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
GenScript corporation lentiviral-based knockout plasmids targeting the vhl gene vhl- crispr guide rna2 plenticrispr v2
Lentiviral Based Knockout Plasmids Targeting The Vhl Gene Vhl Crispr Guide Rna2 Plenticrispr V2, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/10__7554_slash_elife__101299-421-22-41?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
lentiviral-based knockout plasmids targeting the vhl gene vhl- crispr guide rna2 plenticrispr v2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

96
Addgene inc crispr cas9 knockout target genes
Crispr Cas9 Knockout Target Genes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/pm40057593-419-0-46?v=Addgene+inc
Average 96 stars, based on 1 article reviews
crispr cas9 knockout target genes - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

90
Synthego Inc gene knockout kit (crispr-cas9 kit) targeting human cyp2d6
A) Parental (WT) and <t>CYP2D6</t> + progenitor cells were thawed and plated to monitor the cell morphology in phase contrast microscopy at days 3, 7 14 and 30 days after plating. B) Immunoblotting of CYP2D6 and CYP3A4 in parental (WT) and CYP2D6 + cells at different times after plating until days 30 in absence (-) or presence (+) of DMSO. HSC70 protein was used as loading control. C) Dextrometorphan O -demethylase activity (Cl int values expressed in μL.min -1 .mg -1 ) measured in human hepatocytes (PHH), HepaSH cells, parental (WT) and CYP2D6 + HepaRG cells. Statistics: *p < 0.05 and **p< 0.01 between Parental and CYP2D6 + HepaRG cells. D) Inhibition of dextrometorphan O -demethylase activity in CYP2D6 + HepaRG cells by quinidine at 1 and 10 μM. Statistics: *p < 0.05 between parental and CYP2D6 + HepaRG cells (a), and quinidine-treated cells versus untreated CYP2D6 + HepaRG cells (b).
Gene Knockout Kit (Crispr Cas9 Kit) Targeting Human Cyp2d6, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/bio_rxiv__2025__01__25__634872-82-7-11?v=Synthego+Inc
Average 90 stars, based on 1 article reviews
gene knockout kit (crispr-cas9 kit) targeting human cyp2d6 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Synthego Inc target sgrna mix synthego gene knockout kit v2
A) Parental (WT) and <t>CYP2D6</t> + progenitor cells were thawed and plated to monitor the cell morphology in phase contrast microscopy at days 3, 7 14 and 30 days after plating. B) Immunoblotting of CYP2D6 and CYP3A4 in parental (WT) and CYP2D6 + cells at different times after plating until days 30 in absence (-) or presence (+) of DMSO. HSC70 protein was used as loading control. C) Dextrometorphan O -demethylase activity (Cl int values expressed in μL.min -1 .mg -1 ) measured in human hepatocytes (PHH), HepaSH cells, parental (WT) and CYP2D6 + HepaRG cells. Statistics: *p < 0.05 and **p< 0.01 between Parental and CYP2D6 + HepaRG cells. D) Inhibition of dextrometorphan O -demethylase activity in CYP2D6 + HepaRG cells by quinidine at 1 and 10 μM. Statistics: *p < 0.05 between parental and CYP2D6 + HepaRG cells (a), and quinidine-treated cells versus untreated CYP2D6 + HepaRG cells (b).
Target Sgrna Mix Synthego Gene Knockout Kit V2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/pm39868925-279-19-19?v=Synthego+Inc
Average 90 stars, based on 1 article reviews
target sgrna mix synthego gene knockout kit v2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Synthego Inc gene knockout sgrnat kit targeting the rosa26 locus
( A ) Pro-inflammatory gene expression in BMDMs treated with vehicle control (Ctl), Pam3 (50 ng/mL), Poly I:C (1 µg/mL), or Pam3 + Poly I:C for 24 h ( n = 3–7) (*** P < 0.001, ** P = 0.001). ( B ) Levels of nitrite ( n = 3), IL-1β ( n = 3), and IL-12/IL-23 (p40) ( n = 4) in medium collected from BMDMs treated as in ( A ) (* P = 0.01 Pam3 vs. Pam3 + Poly I:C, * P = 0.02 Poly I:C vs. Pam3 + Poly I:C, *** P < 0.001). ( C ) ATP-linked respiration rates for BMDMs harvested from wildtype (WT) or iNOS-null ( Nos2 −/− ) treated with vehicle control (Ctl) or Pam3 + Poly I:C for 24 h ( n = 4) (*** P < 0.001, * P = 0.02). ( D , E ) Pro-inflammatory gene expression ( D ) ( n = 6) and secreted cytokine levels ( E ) ( n = 4) for IL-6 and IL-12β from BMDMs treated as in ( C ) ( D : Il12b: ** P = 0.009,* P = 0.03; Il6 : ** P = 0.007, *** P < 0.001; E : IL-12/IL-23 (p40): * P = 0.04 WT Ctl vs. Pam3 + Poly I:C, * P = 0.05 Nos2 −/ − Ctl vs. Pam3 + Poly I:C; IL-6: * P = 0.02 WT Ctl vs. Pam3 + Poly I:C, * P = 0.03 Nos2 − /− Ctl vs. Pam3 + Poly I:C). ( F ) Schematic of mitochondrial respiratory chain inhibitors used in ( G – J ). CAT carboxyatractyloside. ( G , H ) Pro-inflammatory gene expression for BMDMs treated with vehicle controls (Ctl) and either Pam3 ( G ) ( n = 3–4) or Poly I:C ( H ) ( n = 4) along with the following mitochondrial effector compounds for 24 h: piericidin (100 nM), antimycin A (30 nM), oligomycin (10 nM), oligomycin (10 nM) + Bam15 (3 µM), or CAT (30 µM). ( I ) Cytokine levels from the spent medium of BMDMs treated as in ( G ) ( n = 5) (** P = 0.007). ( J ) Phagocytosis of heat-killed, fluorescently pre-labeled E. coli particles in BMDMs treated as in ( G , H ) ( n = 3) (* P = 0.05, *** P < 0.001, ** P = 0.005 Poly I:C vs. Poly I:C + Piericidin, ** P = 0.004 Poly I:C vs. Poly I:C + Oligomycin). ( K ) Gene expression after CRISPR-mediated knockdown of Ndufs4 in immortalized BMDMs (iBMDMs) relative to control guides targeting <t>Rosa26</t> ( n = 3) (*** P < 0.001). ( L , M ) Representative oxygen consumption trace ( L ) and collated biological replicates ( M ) for iBMDMs as in ( K ). Cells were ‘double permeabilized’ with rPFO (3 nM) and alamethicin (3 ng/mL) to offer NADH or succinate directly to the respiratory chain. R/A, rotenone/antimycin A [ n = 1 biological with 5 technical replicates for ( L ); n = 4 for ( M )]. Where not visible, error bars are obscured by the symbol (*** P < 0.001). ( N ) ATP-linked and maximal respiration rates in intact iBMDMs offered glucose, pyruvate, and glutamine as respiratory substrates ( n = 4) (* P = 0.04, ** P = 0.005). ( O ) Pro-inflammatory gene expression in CRISPR-edited iBMDMs treated with vehicle control (Ctl) or Pam3 (50 ng/mL) for 24 h ( n = 4). All data presented in Fig. 5 are mean ± standard error of the mean (SEM) with statistical analysis conducted on data from biological replicates, each of which included multiple technical replicates, unless otherwise indicated. Cytokine levels in ( B , E , I ) below the threshold of detection are given as zero. Statistical analysis for ( A , B , G – J ) was performed as an ordinary one - way, ANOVA followed by Tukey’s post hoc multiple comparisons test. Statistical analysis for ( C , K , M , O ) was performed as an ordinary two-way, ANOVA followed by Sídák’s post hoc multiple comparisons test. Statistical analysis for ( D , E ) was performed as an ordinary two-way, ANOVA followed by Tukey’s post hoc multiple comparisons test. Statistical analysis for ( N ) was performed as an unpaired, two-tailed t -test. .
Gene Knockout Sgrnat Kit Targeting The Rosa26 Locus, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/pmc11850891-127-0-9?v=Synthego+Inc
Average 90 stars, based on 1 article reviews
gene knockout sgrnat kit targeting the rosa26 locus - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Synthego Inc pooled sgrnas targeting kif18a synthego gene knockout kit v2 sequences
DEPMAP gene essentiality data was used to identify genes required for proliferation of CIN High cells. a Categorization of CIN across 1660 cell lines as CIN High (top quartile), CIN Med or CIN Low (bottom quartile) as measured by fraction genome altered (FGA). Data presented as mean values. Each dot represents 1 cell line. b Volcano plot visualizing the odds ratio from a Fisher’s Exact test to determine the association between RNAi essentiality scores and CIN, which identified genes that are significantly essential in CIN High cell lines (FDR < 0.25). Each dot represents one gene. Genes in green are more essential in CIN High cells, genes in red are more essential in CIN Low cells, and genes in blue did not show differential essentiality. <t>KIF18A</t> p value = 0.0072 with a Fisher’s Exact test. c Cell lines requiring KIF18A for proliferation (Ess) exhibit higher median FGA compared to cell lines not requiring KIF18A for proliferation (Non-Ess) based on RNAi essentiality scores across 748 cell lines. Data presented as median (center) with 25th to 75th percentile bounds (boxes), minimum and maximum (whiskers). ** p = 0.006 by unpaired, 2-tailed t test. Source data are provided in the Source Data file.
Pooled Sgrnas Targeting Kif18a Synthego Gene Knockout Kit V2 Sequences, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/pmc11697083-335-16-19?v=Synthego+Inc
Average 90 stars, based on 1 article reviews
pooled sgrnas targeting kif18a synthego gene knockout kit v2 sequences - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

96
Addgene inc crispr cas9 mediated gene knockout sgrnas targeting genes
DEPMAP gene essentiality data was used to identify genes required for proliferation of CIN High cells. a Categorization of CIN across 1660 cell lines as CIN High (top quartile), CIN Med or CIN Low (bottom quartile) as measured by fraction genome altered (FGA). Data presented as mean values. Each dot represents 1 cell line. b Volcano plot visualizing the odds ratio from a Fisher’s Exact test to determine the association between RNAi essentiality scores and CIN, which identified genes that are significantly essential in CIN High cell lines (FDR < 0.25). Each dot represents one gene. Genes in green are more essential in CIN High cells, genes in red are more essential in CIN Low cells, and genes in blue did not show differential essentiality. <t>KIF18A</t> p value = 0.0072 with a Fisher’s Exact test. c Cell lines requiring KIF18A for proliferation (Ess) exhibit higher median FGA compared to cell lines not requiring KIF18A for proliferation (Non-Ess) based on RNAi essentiality scores across 748 cell lines. Data presented as median (center) with 25th to 75th percentile bounds (boxes), minimum and maximum (whiskers). ** p = 0.006 by unpaired, 2-tailed t test. Source data are provided in the Source Data file.
Crispr Cas9 Mediated Gene Knockout Sgrnas Targeting Genes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/pm38981482-274-0-21?v=Addgene+inc
Average 96 stars, based on 1 article reviews
crispr cas9 mediated gene knockout sgrnas targeting genes - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

90
Synthego Inc guides from synthego crispr gene knockout kit targeting elavl2
DEPMAP gene essentiality data was used to identify genes required for proliferation of CIN High cells. a Categorization of CIN across 1660 cell lines as CIN High (top quartile), CIN Med or CIN Low (bottom quartile) as measured by fraction genome altered (FGA). Data presented as mean values. Each dot represents 1 cell line. b Volcano plot visualizing the odds ratio from a Fisher’s Exact test to determine the association between RNAi essentiality scores and CIN, which identified genes that are significantly essential in CIN High cell lines (FDR < 0.25). Each dot represents one gene. Genes in green are more essential in CIN High cells, genes in red are more essential in CIN Low cells, and genes in blue did not show differential essentiality. <t>KIF18A</t> p value = 0.0072 with a Fisher’s Exact test. c Cell lines requiring KIF18A for proliferation (Ess) exhibit higher median FGA compared to cell lines not requiring KIF18A for proliferation (Non-Ess) based on RNAi essentiality scores across 748 cell lines. Data presented as median (center) with 25th to 75th percentile bounds (boxes), minimum and maximum (whiskers). ** p = 0.006 by unpaired, 2-tailed t test. Source data are provided in the Source Data file.
Guides From Synthego Crispr Gene Knockout Kit Targeting Elavl2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+gene+knockout/pmc11195221__media___1-27-4-7?v=Synthego+Inc
Average 90 stars, based on 1 article reviews
guides from synthego crispr gene knockout kit targeting elavl2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


A) Parental (WT) and CYP2D6 + progenitor cells were thawed and plated to monitor the cell morphology in phase contrast microscopy at days 3, 7 14 and 30 days after plating. B) Immunoblotting of CYP2D6 and CYP3A4 in parental (WT) and CYP2D6 + cells at different times after plating until days 30 in absence (-) or presence (+) of DMSO. HSC70 protein was used as loading control. C) Dextrometorphan O -demethylase activity (Cl int values expressed in μL.min -1 .mg -1 ) measured in human hepatocytes (PHH), HepaSH cells, parental (WT) and CYP2D6 + HepaRG cells. Statistics: *p < 0.05 and **p< 0.01 between Parental and CYP2D6 + HepaRG cells. D) Inhibition of dextrometorphan O -demethylase activity in CYP2D6 + HepaRG cells by quinidine at 1 and 10 μM. Statistics: *p < 0.05 between parental and CYP2D6 + HepaRG cells (a), and quinidine-treated cells versus untreated CYP2D6 + HepaRG cells (b).

Journal: bioRxiv

Article Title: Stable lentiviral-mediated expression of Cytochrome P450 2D6 in HepaRG cells: New means for in vitro assessment of xenobiotic biotransformation and cytotoxicity

doi: 10.1101/2025.01.25.634872

Figure Lengend Snippet: A) Parental (WT) and CYP2D6 + progenitor cells were thawed and plated to monitor the cell morphology in phase contrast microscopy at days 3, 7 14 and 30 days after plating. B) Immunoblotting of CYP2D6 and CYP3A4 in parental (WT) and CYP2D6 + cells at different times after plating until days 30 in absence (-) or presence (+) of DMSO. HSC70 protein was used as loading control. C) Dextrometorphan O -demethylase activity (Cl int values expressed in μL.min -1 .mg -1 ) measured in human hepatocytes (PHH), HepaSH cells, parental (WT) and CYP2D6 + HepaRG cells. Statistics: *p < 0.05 and **p< 0.01 between Parental and CYP2D6 + HepaRG cells. D) Inhibition of dextrometorphan O -demethylase activity in CYP2D6 + HepaRG cells by quinidine at 1 and 10 μM. Statistics: *p < 0.05 between parental and CYP2D6 + HepaRG cells (a), and quinidine-treated cells versus untreated CYP2D6 + HepaRG cells (b).

Article Snippet: The Gene Knockout kit (CRISPR-Cas9 kit) targeting human CYP2D6 purchased form Synthego (Redwood, CA, USA) contained three different sgRNA ( Supporting Information-Table 1 ) and a Cas9 protein batch. sgRNA were resuspended at 30μM in buffer R while Cas9 was ready to use at 20μM.

Techniques: Microscopy, Western Blot, Control, Activity Assay, Inhibition

In situ detection of GFP by fluorescence microscopy (A) and by flow cytometry (B) in hepatocyte- and cholangiocyte-enriched cell populations. For flow cytometry data (B), results are expressed in percentages of GFP positive (Pos) cells and means of fluorescence (FITC-A mean) in both hepatocyte- and cholangiocyte-enriched cell populations. C) Dextrometorphan O -demethylase, phenacetin O-deethylase, bupropion hydroxylase and midazolam 1’-hydroxylase activities probing CYP2D6, CYP1A2, CYP2B66 and CYP3A4/5, respectively, in both hepatocyte- and cholangiocyte-enriched cell populations. All data were significantly different between the two cell populations: ***p < 0.001, ****p < 0.0001. D) In situ detection of CYP2D6 (red staining) and ERAP2 (green staining) by immunofluorescence and mitochondria staining using mitotracker.

Journal: bioRxiv

Article Title: Stable lentiviral-mediated expression of Cytochrome P450 2D6 in HepaRG cells: New means for in vitro assessment of xenobiotic biotransformation and cytotoxicity

doi: 10.1101/2025.01.25.634872

Figure Lengend Snippet: In situ detection of GFP by fluorescence microscopy (A) and by flow cytometry (B) in hepatocyte- and cholangiocyte-enriched cell populations. For flow cytometry data (B), results are expressed in percentages of GFP positive (Pos) cells and means of fluorescence (FITC-A mean) in both hepatocyte- and cholangiocyte-enriched cell populations. C) Dextrometorphan O -demethylase, phenacetin O-deethylase, bupropion hydroxylase and midazolam 1’-hydroxylase activities probing CYP2D6, CYP1A2, CYP2B66 and CYP3A4/5, respectively, in both hepatocyte- and cholangiocyte-enriched cell populations. All data were significantly different between the two cell populations: ***p < 0.001, ****p < 0.0001. D) In situ detection of CYP2D6 (red staining) and ERAP2 (green staining) by immunofluorescence and mitochondria staining using mitotracker.

Article Snippet: The Gene Knockout kit (CRISPR-Cas9 kit) targeting human CYP2D6 purchased form Synthego (Redwood, CA, USA) contained three different sgRNA ( Supporting Information-Table 1 ) and a Cas9 protein batch. sgRNA were resuspended at 30μM in buffer R while Cas9 was ready to use at 20μM.

Techniques: In Situ, Fluorescence, Microscopy, Flow Cytometry, Staining, Immunofluorescence

A) Schematic representation of the biotransformation of tramadol via CYP2D6, CYP2B6 and CYP3A4 enzymatic activities and the main metabolites of tramadol: M1: O -desmethyltramadol, M2: N -desmethyltramadol, M3: N , N -bidesmethyltramadol, M4: O -desmethyl- N , N -bisdesmethyltramadol, M5: N , O -didesmethyltramadol (M1, M2, M3, M4 and M5). B) Chromatograms of M1-M2 metabolites detected in parental (HepaRG WT) and CYP2D6 + transgenic HepaRG cells. C) Table presenting the quantification LC–MS/MS analysis of metabolites M1 to M5 in progenitor and differentiated parental (WT) and CYP2D6 + HepaRG cells. Results were expressed in µg/L.

Journal: bioRxiv

Article Title: Stable lentiviral-mediated expression of Cytochrome P450 2D6 in HepaRG cells: New means for in vitro assessment of xenobiotic biotransformation and cytotoxicity

doi: 10.1101/2025.01.25.634872

Figure Lengend Snippet: A) Schematic representation of the biotransformation of tramadol via CYP2D6, CYP2B6 and CYP3A4 enzymatic activities and the main metabolites of tramadol: M1: O -desmethyltramadol, M2: N -desmethyltramadol, M3: N , N -bidesmethyltramadol, M4: O -desmethyl- N , N -bisdesmethyltramadol, M5: N , O -didesmethyltramadol (M1, M2, M3, M4 and M5). B) Chromatograms of M1-M2 metabolites detected in parental (HepaRG WT) and CYP2D6 + transgenic HepaRG cells. C) Table presenting the quantification LC–MS/MS analysis of metabolites M1 to M5 in progenitor and differentiated parental (WT) and CYP2D6 + HepaRG cells. Results were expressed in µg/L.

Article Snippet: The Gene Knockout kit (CRISPR-Cas9 kit) targeting human CYP2D6 purchased form Synthego (Redwood, CA, USA) contained three different sgRNA ( Supporting Information-Table 1 ) and a Cas9 protein batch. sgRNA were resuspended at 30μM in buffer R while Cas9 was ready to use at 20μM.

Techniques: Transgenic Assay, Liquid Chromatography with Mass Spectroscopy

A) Relative ATP contents (left panel) and LDH release (right panel) and B) IC 50 in parental (WT) and CYP2D6 + differentiated HepaRG cells exposed to various concentration of perhexiline. C) Oxygen Consumption Rate (OCR) in parental (WT) and CYP2D6 + differentiated HepaRG cells exposed to perhexiline at 10μM and quantifications of proton leak, ATP production and coupling efficiency (left panel) and D) levels of mitochondrial β-oxidation of linoleic acid. All data were significantly different between the two cell lines: *p < 0.05 and **p< 0.01

Journal: bioRxiv

Article Title: Stable lentiviral-mediated expression of Cytochrome P450 2D6 in HepaRG cells: New means for in vitro assessment of xenobiotic biotransformation and cytotoxicity

doi: 10.1101/2025.01.25.634872

Figure Lengend Snippet: A) Relative ATP contents (left panel) and LDH release (right panel) and B) IC 50 in parental (WT) and CYP2D6 + differentiated HepaRG cells exposed to various concentration of perhexiline. C) Oxygen Consumption Rate (OCR) in parental (WT) and CYP2D6 + differentiated HepaRG cells exposed to perhexiline at 10μM and quantifications of proton leak, ATP production and coupling efficiency (left panel) and D) levels of mitochondrial β-oxidation of linoleic acid. All data were significantly different between the two cell lines: *p < 0.05 and **p< 0.01

Article Snippet: The Gene Knockout kit (CRISPR-Cas9 kit) targeting human CYP2D6 purchased form Synthego (Redwood, CA, USA) contained three different sgRNA ( Supporting Information-Table 1 ) and a Cas9 protein batch. sgRNA were resuspended at 30μM in buffer R while Cas9 was ready to use at 20μM.

Techniques: Concentration Assay

A) UMAP representation of parental (WT) and CYP2D6 + HepaRG cells at different time points after plating (2, 4, 7, 14, 32, 37 and 44 days). The first dimension is mainly associated to the time of culture. B) Heatmap of the top 100 most differentially expressed genes during differentiation, with consistent expression patterns observed between parental (WT and CYP2D6 + HepaRG cells. C) Volcano plot of genes differentially expressed at D37 highlighting significant downregulation of various CYP450 genes in transgenic cells compared to parental cells. D) Radar plot showing enrichment of gene ontology (GO) terms related to xenobiotic metabolism at D37 and D44. The size of the points is the ratio r/R and the scale corresponds to the log10 of the adjusted p-value, where r = number of genes in the list associated with the term of interest and R = total number of genes associated with one term of interest.

Journal: bioRxiv

Article Title: Stable lentiviral-mediated expression of Cytochrome P450 2D6 in HepaRG cells: New means for in vitro assessment of xenobiotic biotransformation and cytotoxicity

doi: 10.1101/2025.01.25.634872

Figure Lengend Snippet: A) UMAP representation of parental (WT) and CYP2D6 + HepaRG cells at different time points after plating (2, 4, 7, 14, 32, 37 and 44 days). The first dimension is mainly associated to the time of culture. B) Heatmap of the top 100 most differentially expressed genes during differentiation, with consistent expression patterns observed between parental (WT and CYP2D6 + HepaRG cells. C) Volcano plot of genes differentially expressed at D37 highlighting significant downregulation of various CYP450 genes in transgenic cells compared to parental cells. D) Radar plot showing enrichment of gene ontology (GO) terms related to xenobiotic metabolism at D37 and D44. The size of the points is the ratio r/R and the scale corresponds to the log10 of the adjusted p-value, where r = number of genes in the list associated with the term of interest and R = total number of genes associated with one term of interest.

Article Snippet: The Gene Knockout kit (CRISPR-Cas9 kit) targeting human CYP2D6 purchased form Synthego (Redwood, CA, USA) contained three different sgRNA ( Supporting Information-Table 1 ) and a Cas9 protein batch. sgRNA were resuspended at 30μM in buffer R while Cas9 was ready to use at 20μM.

Techniques: Expressing, Transgenic Assay

A) Detection of GFP by fluorescence microscopy and by flow cytometry in CYP2D6 + and KO CYP2D6/GFP HepaRG cells. Results are expressed in percentages of GFP positive (Pos) or negative (Neg) cells and means of fluorescence (FITC-A mean). B) RT-qPCR evaluating the relative mRNA expression of CYP2D6, 3A4, 2C8, 2C9, 2A7, AhR, FXR, PXR, HNF4α and SHP in parental (HRP WT), CYP2D6 + and KO CYP2D6/GFP (HRP KO) HepaRG cells. Statistics: *p < 0.05 between parental (HRP WT = a), CYP2D6 + (b) and KO CYP2D6/GFP (HRP KO = c) HepaRG cells.

Journal: bioRxiv

Article Title: Stable lentiviral-mediated expression of Cytochrome P450 2D6 in HepaRG cells: New means for in vitro assessment of xenobiotic biotransformation and cytotoxicity

doi: 10.1101/2025.01.25.634872

Figure Lengend Snippet: A) Detection of GFP by fluorescence microscopy and by flow cytometry in CYP2D6 + and KO CYP2D6/GFP HepaRG cells. Results are expressed in percentages of GFP positive (Pos) or negative (Neg) cells and means of fluorescence (FITC-A mean). B) RT-qPCR evaluating the relative mRNA expression of CYP2D6, 3A4, 2C8, 2C9, 2A7, AhR, FXR, PXR, HNF4α and SHP in parental (HRP WT), CYP2D6 + and KO CYP2D6/GFP (HRP KO) HepaRG cells. Statistics: *p < 0.05 between parental (HRP WT = a), CYP2D6 + (b) and KO CYP2D6/GFP (HRP KO = c) HepaRG cells.

Article Snippet: The Gene Knockout kit (CRISPR-Cas9 kit) targeting human CYP2D6 purchased form Synthego (Redwood, CA, USA) contained three different sgRNA ( Supporting Information-Table 1 ) and a Cas9 protein batch. sgRNA were resuspended at 30μM in buffer R while Cas9 was ready to use at 20μM.

Techniques: Fluorescence, Microscopy, Flow Cytometry, Quantitative RT-PCR, Expressing

A) Schematic representation of the lentiviral derived mRNA transcribed from the transgene inserted into the genome of HepaRG cells and CRISPR/Cas9 mediated alteration of the lentiviral transgene in KO CYP2D6/GFP (HRP KO) HepaRG cells. B) RT-qPCR evaluating the relative mRNA expression of the CYP2D6-GFP-WPRE lentiviral derived transcript and NXF3 and TRIM63 in CYP2D6 + and KO CYP2D6/GFP HepaRG cells. Statistics: *p < 0.05 between parental (HRP WT = a), CYP2D6 + (b) and KO CYP2D6/GFP (HRP KO = c) HepaRG cells.

Journal: bioRxiv

Article Title: Stable lentiviral-mediated expression of Cytochrome P450 2D6 in HepaRG cells: New means for in vitro assessment of xenobiotic biotransformation and cytotoxicity

doi: 10.1101/2025.01.25.634872

Figure Lengend Snippet: A) Schematic representation of the lentiviral derived mRNA transcribed from the transgene inserted into the genome of HepaRG cells and CRISPR/Cas9 mediated alteration of the lentiviral transgene in KO CYP2D6/GFP (HRP KO) HepaRG cells. B) RT-qPCR evaluating the relative mRNA expression of the CYP2D6-GFP-WPRE lentiviral derived transcript and NXF3 and TRIM63 in CYP2D6 + and KO CYP2D6/GFP HepaRG cells. Statistics: *p < 0.05 between parental (HRP WT = a), CYP2D6 + (b) and KO CYP2D6/GFP (HRP KO = c) HepaRG cells.

Article Snippet: The Gene Knockout kit (CRISPR-Cas9 kit) targeting human CYP2D6 purchased form Synthego (Redwood, CA, USA) contained three different sgRNA ( Supporting Information-Table 1 ) and a Cas9 protein batch. sgRNA were resuspended at 30μM in buffer R while Cas9 was ready to use at 20μM.

Techniques: Derivative Assay, CRISPR, Quantitative RT-PCR, Expressing

( A ) Pro-inflammatory gene expression in BMDMs treated with vehicle control (Ctl), Pam3 (50 ng/mL), Poly I:C (1 µg/mL), or Pam3 + Poly I:C for 24 h ( n = 3–7) (*** P < 0.001, ** P = 0.001). ( B ) Levels of nitrite ( n = 3), IL-1β ( n = 3), and IL-12/IL-23 (p40) ( n = 4) in medium collected from BMDMs treated as in ( A ) (* P = 0.01 Pam3 vs. Pam3 + Poly I:C, * P = 0.02 Poly I:C vs. Pam3 + Poly I:C, *** P < 0.001). ( C ) ATP-linked respiration rates for BMDMs harvested from wildtype (WT) or iNOS-null ( Nos2 −/− ) treated with vehicle control (Ctl) or Pam3 + Poly I:C for 24 h ( n = 4) (*** P < 0.001, * P = 0.02). ( D , E ) Pro-inflammatory gene expression ( D ) ( n = 6) and secreted cytokine levels ( E ) ( n = 4) for IL-6 and IL-12β from BMDMs treated as in ( C ) ( D : Il12b: ** P = 0.009,* P = 0.03; Il6 : ** P = 0.007, *** P < 0.001; E : IL-12/IL-23 (p40): * P = 0.04 WT Ctl vs. Pam3 + Poly I:C, * P = 0.05 Nos2 −/ − Ctl vs. Pam3 + Poly I:C; IL-6: * P = 0.02 WT Ctl vs. Pam3 + Poly I:C, * P = 0.03 Nos2 − /− Ctl vs. Pam3 + Poly I:C). ( F ) Schematic of mitochondrial respiratory chain inhibitors used in ( G – J ). CAT carboxyatractyloside. ( G , H ) Pro-inflammatory gene expression for BMDMs treated with vehicle controls (Ctl) and either Pam3 ( G ) ( n = 3–4) or Poly I:C ( H ) ( n = 4) along with the following mitochondrial effector compounds for 24 h: piericidin (100 nM), antimycin A (30 nM), oligomycin (10 nM), oligomycin (10 nM) + Bam15 (3 µM), or CAT (30 µM). ( I ) Cytokine levels from the spent medium of BMDMs treated as in ( G ) ( n = 5) (** P = 0.007). ( J ) Phagocytosis of heat-killed, fluorescently pre-labeled E. coli particles in BMDMs treated as in ( G , H ) ( n = 3) (* P = 0.05, *** P < 0.001, ** P = 0.005 Poly I:C vs. Poly I:C + Piericidin, ** P = 0.004 Poly I:C vs. Poly I:C + Oligomycin). ( K ) Gene expression after CRISPR-mediated knockdown of Ndufs4 in immortalized BMDMs (iBMDMs) relative to control guides targeting Rosa26 ( n = 3) (*** P < 0.001). ( L , M ) Representative oxygen consumption trace ( L ) and collated biological replicates ( M ) for iBMDMs as in ( K ). Cells were ‘double permeabilized’ with rPFO (3 nM) and alamethicin (3 ng/mL) to offer NADH or succinate directly to the respiratory chain. R/A, rotenone/antimycin A [ n = 1 biological with 5 technical replicates for ( L ); n = 4 for ( M )]. Where not visible, error bars are obscured by the symbol (*** P < 0.001). ( N ) ATP-linked and maximal respiration rates in intact iBMDMs offered glucose, pyruvate, and glutamine as respiratory substrates ( n = 4) (* P = 0.04, ** P = 0.005). ( O ) Pro-inflammatory gene expression in CRISPR-edited iBMDMs treated with vehicle control (Ctl) or Pam3 (50 ng/mL) for 24 h ( n = 4). All data presented in Fig. 5 are mean ± standard error of the mean (SEM) with statistical analysis conducted on data from biological replicates, each of which included multiple technical replicates, unless otherwise indicated. Cytokine levels in ( B , E , I ) below the threshold of detection are given as zero. Statistical analysis for ( A , B , G – J ) was performed as an ordinary one - way, ANOVA followed by Tukey’s post hoc multiple comparisons test. Statistical analysis for ( C , K , M , O ) was performed as an ordinary two-way, ANOVA followed by Sídák’s post hoc multiple comparisons test. Statistical analysis for ( D , E ) was performed as an ordinary two-way, ANOVA followed by Tukey’s post hoc multiple comparisons test. Statistical analysis for ( N ) was performed as an unpaired, two-tailed t -test. .

Journal: EMBO Reports

Article Title: Pro-inflammatory macrophage activation does not require inhibition of oxidative phosphorylation

doi: 10.1038/s44319-024-00351-y

Figure Lengend Snippet: ( A ) Pro-inflammatory gene expression in BMDMs treated with vehicle control (Ctl), Pam3 (50 ng/mL), Poly I:C (1 µg/mL), or Pam3 + Poly I:C for 24 h ( n = 3–7) (*** P < 0.001, ** P = 0.001). ( B ) Levels of nitrite ( n = 3), IL-1β ( n = 3), and IL-12/IL-23 (p40) ( n = 4) in medium collected from BMDMs treated as in ( A ) (* P = 0.01 Pam3 vs. Pam3 + Poly I:C, * P = 0.02 Poly I:C vs. Pam3 + Poly I:C, *** P < 0.001). ( C ) ATP-linked respiration rates for BMDMs harvested from wildtype (WT) or iNOS-null ( Nos2 −/− ) treated with vehicle control (Ctl) or Pam3 + Poly I:C for 24 h ( n = 4) (*** P < 0.001, * P = 0.02). ( D , E ) Pro-inflammatory gene expression ( D ) ( n = 6) and secreted cytokine levels ( E ) ( n = 4) for IL-6 and IL-12β from BMDMs treated as in ( C ) ( D : Il12b: ** P = 0.009,* P = 0.03; Il6 : ** P = 0.007, *** P < 0.001; E : IL-12/IL-23 (p40): * P = 0.04 WT Ctl vs. Pam3 + Poly I:C, * P = 0.05 Nos2 −/ − Ctl vs. Pam3 + Poly I:C; IL-6: * P = 0.02 WT Ctl vs. Pam3 + Poly I:C, * P = 0.03 Nos2 − /− Ctl vs. Pam3 + Poly I:C). ( F ) Schematic of mitochondrial respiratory chain inhibitors used in ( G – J ). CAT carboxyatractyloside. ( G , H ) Pro-inflammatory gene expression for BMDMs treated with vehicle controls (Ctl) and either Pam3 ( G ) ( n = 3–4) or Poly I:C ( H ) ( n = 4) along with the following mitochondrial effector compounds for 24 h: piericidin (100 nM), antimycin A (30 nM), oligomycin (10 nM), oligomycin (10 nM) + Bam15 (3 µM), or CAT (30 µM). ( I ) Cytokine levels from the spent medium of BMDMs treated as in ( G ) ( n = 5) (** P = 0.007). ( J ) Phagocytosis of heat-killed, fluorescently pre-labeled E. coli particles in BMDMs treated as in ( G , H ) ( n = 3) (* P = 0.05, *** P < 0.001, ** P = 0.005 Poly I:C vs. Poly I:C + Piericidin, ** P = 0.004 Poly I:C vs. Poly I:C + Oligomycin). ( K ) Gene expression after CRISPR-mediated knockdown of Ndufs4 in immortalized BMDMs (iBMDMs) relative to control guides targeting Rosa26 ( n = 3) (*** P < 0.001). ( L , M ) Representative oxygen consumption trace ( L ) and collated biological replicates ( M ) for iBMDMs as in ( K ). Cells were ‘double permeabilized’ with rPFO (3 nM) and alamethicin (3 ng/mL) to offer NADH or succinate directly to the respiratory chain. R/A, rotenone/antimycin A [ n = 1 biological with 5 technical replicates for ( L ); n = 4 for ( M )]. Where not visible, error bars are obscured by the symbol (*** P < 0.001). ( N ) ATP-linked and maximal respiration rates in intact iBMDMs offered glucose, pyruvate, and glutamine as respiratory substrates ( n = 4) (* P = 0.04, ** P = 0.005). ( O ) Pro-inflammatory gene expression in CRISPR-edited iBMDMs treated with vehicle control (Ctl) or Pam3 (50 ng/mL) for 24 h ( n = 4). All data presented in Fig. 5 are mean ± standard error of the mean (SEM) with statistical analysis conducted on data from biological replicates, each of which included multiple technical replicates, unless otherwise indicated. Cytokine levels in ( B , E , I ) below the threshold of detection are given as zero. Statistical analysis for ( A , B , G – J ) was performed as an ordinary one - way, ANOVA followed by Tukey’s post hoc multiple comparisons test. Statistical analysis for ( C , K , M , O ) was performed as an ordinary two-way, ANOVA followed by Sídák’s post hoc multiple comparisons test. Statistical analysis for ( D , E ) was performed as an ordinary two-way, ANOVA followed by Tukey’s post hoc multiple comparisons test. Statistical analysis for ( N ) was performed as an unpaired, two-tailed t -test. .

Article Snippet: Gene knockout sgRNAt kit targeting the rosa26 locus , SYNTHEGO , N/A.

Techniques: Gene Expression, Control, Labeling, CRISPR, Knockdown, Two Tailed Test

Reagents and tools table

Journal: EMBO Reports

Article Title: Pro-inflammatory macrophage activation does not require inhibition of oxidative phosphorylation

doi: 10.1038/s44319-024-00351-y

Figure Lengend Snippet: Reagents and tools table

Article Snippet: Gene knockout sgRNAt kit targeting the rosa26 locus , SYNTHEGO , N/A.

Techniques: Sequencing, Cell Culture, Red Blood Cell Lysis, Recombinant, Clinical Proteomics, Membrane, Saline, Electroporation, Software, High Content Screening, Flow Cytometry, Reverse Transcription, SYBR Green Assay, Enzyme-linked Immunosorbent Assay, Luminex, Phagocytosis Assay, Transfection, Gene Knockout

DEPMAP gene essentiality data was used to identify genes required for proliferation of CIN High cells. a Categorization of CIN across 1660 cell lines as CIN High (top quartile), CIN Med or CIN Low (bottom quartile) as measured by fraction genome altered (FGA). Data presented as mean values. Each dot represents 1 cell line. b Volcano plot visualizing the odds ratio from a Fisher’s Exact test to determine the association between RNAi essentiality scores and CIN, which identified genes that are significantly essential in CIN High cell lines (FDR < 0.25). Each dot represents one gene. Genes in green are more essential in CIN High cells, genes in red are more essential in CIN Low cells, and genes in blue did not show differential essentiality. KIF18A p value = 0.0072 with a Fisher’s Exact test. c Cell lines requiring KIF18A for proliferation (Ess) exhibit higher median FGA compared to cell lines not requiring KIF18A for proliferation (Non-Ess) based on RNAi essentiality scores across 748 cell lines. Data presented as median (center) with 25th to 75th percentile bounds (boxes), minimum and maximum (whiskers). ** p = 0.006 by unpaired, 2-tailed t test. Source data are provided in the Source Data file.

Journal: Nature Communications

Article Title: Targeting chromosomally unstable tumors with a selective KIF18A inhibitor

doi: 10.1038/s41467-024-55300-z

Figure Lengend Snippet: DEPMAP gene essentiality data was used to identify genes required for proliferation of CIN High cells. a Categorization of CIN across 1660 cell lines as CIN High (top quartile), CIN Med or CIN Low (bottom quartile) as measured by fraction genome altered (FGA). Data presented as mean values. Each dot represents 1 cell line. b Volcano plot visualizing the odds ratio from a Fisher’s Exact test to determine the association between RNAi essentiality scores and CIN, which identified genes that are significantly essential in CIN High cell lines (FDR < 0.25). Each dot represents one gene. Genes in green are more essential in CIN High cells, genes in red are more essential in CIN Low cells, and genes in blue did not show differential essentiality. KIF18A p value = 0.0072 with a Fisher’s Exact test. c Cell lines requiring KIF18A for proliferation (Ess) exhibit higher median FGA compared to cell lines not requiring KIF18A for proliferation (Non-Ess) based on RNAi essentiality scores across 748 cell lines. Data presented as median (center) with 25th to 75th percentile bounds (boxes), minimum and maximum (whiskers). ** p = 0.006 by unpaired, 2-tailed t test. Source data are provided in the Source Data file.

Article Snippet: MDA-MB-231-Cas9-KIF2A or MDA-MB-231-Cas9-KIF2B cells were transfected twice with non-targeting sgRNA (Synthego scrambled sgRNA #1) or pooled sgRNAs targeting KIF18A (Synthego Gene Knockout Kit v2 sequences 5’- AAACUGACUUCUUCUUGUUU, 5’- AGCAGCUGGAUUUCAUAAAG, 5’- AUCAACAAUGUCUGUCACUG) using RNAiMAX (Thermo 13778-075), according to the manufacturer’s protocol.

Techniques:

a Micronuclei levels (ratio of total micronuclei to total primary nuclei) in MDA-MB-231 cells over-expressing KIF2B or KIF2A compared to the parental line. Data presented as mean values -/+ SD from n = 6 biological replicates, *** p = 1.01 x 10 − 4 using one-way ANOVA with Dunnett’s multiple comparisons test. b Defective anaphases (as percentage of total anaphases) in MDA-MB-231 cells overexpressing KIF2A or KIF2B. Data presented as mean values from n = 2 biological replicates. c Western blot confirming CRISPR/Cas9-mediated KIF18A knockout. One representative experiment of 2 biological replicates is shown. d Proliferation (luminescence measured by CellTiter-Glo assay) upon KIF18A knockout. Data presented as individual values from n = 2 biological replicates. (e) Western blot of KIF18A knockdown (K1 and K2) compared to control siRNA (C1 and C2) 72 h after replating. Top panel: arrow indicates KIF18A (the highest band), bottom band is non-specific. One representative experiment of 2 biological replicates is shown. f Viability of cells shown in (e) 72 h after replating following siRNA transfection. Computed CIN values (FGA) of cell lines are indicated below the name. Data are presented as mean values from 2 biological replicates. g Western blot of KIF18A expression in engineered Dox-inducible KIF18A (shRNA 1 and 2) and Control (non-targeting) shRNA in JIMT-1 cells after 7 days Dox treatment. One representative experiment of 2 biological replicates is shown. h Proliferation of engineered Dox-inducible JIMT-1 cells measured after 10 days Dox treatment. Data presented as mean values +/- SD from n = 3 biological replicates. p values are indicated above the bars and determined by 2-way ANOVA with Tukey’s multiple comparisons test. i Cell cycle population frequencies in Dox-inducible KIF18A and Control shRNA JIMT-1 cells after 72 h of Dox treatment. Data presented as mean values from n = 2 biological replicates. j Tumor volume of Dox-inducible shRNA JIMT-1 xenografts implanted in SCID Beige mice ( n = 4 mice per group). Data presented as mean values -/+ SEM. k Western blot of KIF18A expression from JIMT-1 xenograft tumors excised 4 days after initiation of Dox treatments. Source data are provided in the Source Data file.

Journal: Nature Communications

Article Title: Targeting chromosomally unstable tumors with a selective KIF18A inhibitor

doi: 10.1038/s41467-024-55300-z

Figure Lengend Snippet: a Micronuclei levels (ratio of total micronuclei to total primary nuclei) in MDA-MB-231 cells over-expressing KIF2B or KIF2A compared to the parental line. Data presented as mean values -/+ SD from n = 6 biological replicates, *** p = 1.01 x 10 − 4 using one-way ANOVA with Dunnett’s multiple comparisons test. b Defective anaphases (as percentage of total anaphases) in MDA-MB-231 cells overexpressing KIF2A or KIF2B. Data presented as mean values from n = 2 biological replicates. c Western blot confirming CRISPR/Cas9-mediated KIF18A knockout. One representative experiment of 2 biological replicates is shown. d Proliferation (luminescence measured by CellTiter-Glo assay) upon KIF18A knockout. Data presented as individual values from n = 2 biological replicates. (e) Western blot of KIF18A knockdown (K1 and K2) compared to control siRNA (C1 and C2) 72 h after replating. Top panel: arrow indicates KIF18A (the highest band), bottom band is non-specific. One representative experiment of 2 biological replicates is shown. f Viability of cells shown in (e) 72 h after replating following siRNA transfection. Computed CIN values (FGA) of cell lines are indicated below the name. Data are presented as mean values from 2 biological replicates. g Western blot of KIF18A expression in engineered Dox-inducible KIF18A (shRNA 1 and 2) and Control (non-targeting) shRNA in JIMT-1 cells after 7 days Dox treatment. One representative experiment of 2 biological replicates is shown. h Proliferation of engineered Dox-inducible JIMT-1 cells measured after 10 days Dox treatment. Data presented as mean values +/- SD from n = 3 biological replicates. p values are indicated above the bars and determined by 2-way ANOVA with Tukey’s multiple comparisons test. i Cell cycle population frequencies in Dox-inducible KIF18A and Control shRNA JIMT-1 cells after 72 h of Dox treatment. Data presented as mean values from n = 2 biological replicates. j Tumor volume of Dox-inducible shRNA JIMT-1 xenografts implanted in SCID Beige mice ( n = 4 mice per group). Data presented as mean values -/+ SEM. k Western blot of KIF18A expression from JIMT-1 xenograft tumors excised 4 days after initiation of Dox treatments. Source data are provided in the Source Data file.

Article Snippet: MDA-MB-231-Cas9-KIF2A or MDA-MB-231-Cas9-KIF2B cells were transfected twice with non-targeting sgRNA (Synthego scrambled sgRNA #1) or pooled sgRNAs targeting KIF18A (Synthego Gene Knockout Kit v2 sequences 5’- AAACUGACUUCUUCUUGUUU, 5’- AGCAGCUGGAUUUCAUAAAG, 5’- AUCAACAAUGUCUGUCACUG) using RNAiMAX (Thermo 13778-075), according to the manufacturer’s protocol.

Techniques: Expressing, Western Blot, CRISPR, Knock-Out, Glo Assay, Knockdown, Control, Transfection, shRNA

a Structure of VLS-1272. b Potency of VLS-1272 in a KIF18A (1-374) biochemical ADP-Glo assay to measure ATPase activity with varied concentrations of ATP. Data presented as mean values from n = 2 biological replicates. c Inhibition of KIF18A (1-374) by VLS-1272 as measured by ADP-Glo assay in the absence or presence of 0.1 mg/ml microtubules. Data presented as individual values from n = 2 biological replicates. d Representative still images from microtubule gliding filament assays with purified KIF18A 1-480-GFP linked to the glass surface in absence (control) or presence of VLS-1272. Arrows indicate the ends of microtubules that move directionally (control) or remain stationary (VLS-1272). e Plot of microtubule velocities measured in gliding filament assays in the presence or absence of VLS-1272. n = 249 (control) and 177 (VLS-1272) microtubules from 3 independent experiments. Data were compared using an unpaired, two-tailed t -test. **** p < 1.0 x 10 -15 . Data points represent individual microtubule velocities, bars indicate mean and standard deviation. f Potency of VLS-1272 at various timepoints from a global progress curve analysis (GPCA). Data presented as mean values -/+ SD from n = 11 biological replicates. g Inhibition of HCC15 cell proliferation after 4-day treatment with VLS-1272 (black) versus 1 day of VLS-1272 treatment followed by a washout and replacement in media without inhibitor for an additional 3 days (pink). Data presented as individual values from n = 2 biological replicates. h Comparison of the K I calculated by GPCA vs. the EC50 from a 2.5-day CellTiter-Glo proliferation assay in JIMT-1 cells from n = 40 compounds. Each dot represents one compound. Compounds with poor permeability are denoted by “x”. Source data are provided in the Source Data file.

Journal: Nature Communications

Article Title: Targeting chromosomally unstable tumors with a selective KIF18A inhibitor

doi: 10.1038/s41467-024-55300-z

Figure Lengend Snippet: a Structure of VLS-1272. b Potency of VLS-1272 in a KIF18A (1-374) biochemical ADP-Glo assay to measure ATPase activity with varied concentrations of ATP. Data presented as mean values from n = 2 biological replicates. c Inhibition of KIF18A (1-374) by VLS-1272 as measured by ADP-Glo assay in the absence or presence of 0.1 mg/ml microtubules. Data presented as individual values from n = 2 biological replicates. d Representative still images from microtubule gliding filament assays with purified KIF18A 1-480-GFP linked to the glass surface in absence (control) or presence of VLS-1272. Arrows indicate the ends of microtubules that move directionally (control) or remain stationary (VLS-1272). e Plot of microtubule velocities measured in gliding filament assays in the presence or absence of VLS-1272. n = 249 (control) and 177 (VLS-1272) microtubules from 3 independent experiments. Data were compared using an unpaired, two-tailed t -test. **** p < 1.0 x 10 -15 . Data points represent individual microtubule velocities, bars indicate mean and standard deviation. f Potency of VLS-1272 at various timepoints from a global progress curve analysis (GPCA). Data presented as mean values -/+ SD from n = 11 biological replicates. g Inhibition of HCC15 cell proliferation after 4-day treatment with VLS-1272 (black) versus 1 day of VLS-1272 treatment followed by a washout and replacement in media without inhibitor for an additional 3 days (pink). Data presented as individual values from n = 2 biological replicates. h Comparison of the K I calculated by GPCA vs. the EC50 from a 2.5-day CellTiter-Glo proliferation assay in JIMT-1 cells from n = 40 compounds. Each dot represents one compound. Compounds with poor permeability are denoted by “x”. Source data are provided in the Source Data file.

Article Snippet: MDA-MB-231-Cas9-KIF2A or MDA-MB-231-Cas9-KIF2B cells were transfected twice with non-targeting sgRNA (Synthego scrambled sgRNA #1) or pooled sgRNAs targeting KIF18A (Synthego Gene Knockout Kit v2 sequences 5’- AAACUGACUUCUUCUUGUUU, 5’- AGCAGCUGGAUUUCAUAAAG, 5’- AUCAACAAUGUCUGUCACUG) using RNAiMAX (Thermo 13778-075), according to the manufacturer’s protocol.

Techniques: Glo Assay, Activity Assay, Inhibition, Purification, Control, Two Tailed Test, Standard Deviation, Comparison, Proliferation Assay, Permeability

Selectivity summary for VLS-1272 against a panel of human and mouse kinesins

Journal: Nature Communications

Article Title: Targeting chromosomally unstable tumors with a selective KIF18A inhibitor

doi: 10.1038/s41467-024-55300-z

Figure Lengend Snippet: Selectivity summary for VLS-1272 against a panel of human and mouse kinesins

Article Snippet: MDA-MB-231-Cas9-KIF2A or MDA-MB-231-Cas9-KIF2B cells were transfected twice with non-targeting sgRNA (Synthego scrambled sgRNA #1) or pooled sgRNAs targeting KIF18A (Synthego Gene Knockout Kit v2 sequences 5’- AAACUGACUUCUUCUUGUUU, 5’- AGCAGCUGGAUUUCAUAAAG, 5’- AUCAACAAUGUCUGUCACUG) using RNAiMAX (Thermo 13778-075), according to the manufacturer’s protocol.

Techniques:

a Representative immunofluorescence images of HCC1806 cells treated with DMSO (top) or 37.5 nM VLS-1272 (bottom). Scale bar = 5 µm. One representative image from the treatment and control group from two biological replicates is shown. b Quantification of KIF18A mis-localization in mitotic HCC1806 cells measured as the ratio of KIF18A colocalizing with the α-tubulin spindle to KIF18A colocalizing with DNA (DAPI). Colocalization masks were generated in Harmony high-content analysis software. Data presented as violin plots with the mean (solid line) and quartiles (dashed lines) from n = 233-803 mitotic cells. Adjusted p value is calculated compared to untreated control and labeled next to each condition, using one-way ANOVA with Bonferroni’s multiple comparisons test. c Representative fluorescent images of DAPI-stained mitotic DNA in HCC1806 cells treated with DMSO or VLS-1272. Scale bar = 5 µm. One representative image from the treatment and control group from two biological replicates is shown. d Quantification of the area of DAPI staining (µm 2 ) in pHH3-positive cells treated with increasing doses of VLS-1272. The area of the DAPI-stained DNA was calculated in Harmony high-content analysis software. Data presented as violin plots with the mean (solid line) and quartiles (dashed lines) from n = 652–1434 mitotic cells. Adjusted p value is calculated compared to untreated control and labeled next to each condition, using one-way ANOVA with Bonferroni’s multiple comparisons test. e Quantification of mitotic HCC1806 cells identified by positive staining for pHH3 compared to the number of total DAPI-stained nuclei. The mitotic cell population was calculated in Harmony high-content analysis software. f Percentage of total micronuclei to primary nuclei in cells treated with VLS-1272, calculated in Harmony high-content analysis software. e , f Data presented as mean values with individual data points shown from n = 2 biological replicates. Source data are provided in the Source Data file.

Journal: Nature Communications

Article Title: Targeting chromosomally unstable tumors with a selective KIF18A inhibitor

doi: 10.1038/s41467-024-55300-z

Figure Lengend Snippet: a Representative immunofluorescence images of HCC1806 cells treated with DMSO (top) or 37.5 nM VLS-1272 (bottom). Scale bar = 5 µm. One representative image from the treatment and control group from two biological replicates is shown. b Quantification of KIF18A mis-localization in mitotic HCC1806 cells measured as the ratio of KIF18A colocalizing with the α-tubulin spindle to KIF18A colocalizing with DNA (DAPI). Colocalization masks were generated in Harmony high-content analysis software. Data presented as violin plots with the mean (solid line) and quartiles (dashed lines) from n = 233-803 mitotic cells. Adjusted p value is calculated compared to untreated control and labeled next to each condition, using one-way ANOVA with Bonferroni’s multiple comparisons test. c Representative fluorescent images of DAPI-stained mitotic DNA in HCC1806 cells treated with DMSO or VLS-1272. Scale bar = 5 µm. One representative image from the treatment and control group from two biological replicates is shown. d Quantification of the area of DAPI staining (µm 2 ) in pHH3-positive cells treated with increasing doses of VLS-1272. The area of the DAPI-stained DNA was calculated in Harmony high-content analysis software. Data presented as violin plots with the mean (solid line) and quartiles (dashed lines) from n = 652–1434 mitotic cells. Adjusted p value is calculated compared to untreated control and labeled next to each condition, using one-way ANOVA with Bonferroni’s multiple comparisons test. e Quantification of mitotic HCC1806 cells identified by positive staining for pHH3 compared to the number of total DAPI-stained nuclei. The mitotic cell population was calculated in Harmony high-content analysis software. f Percentage of total micronuclei to primary nuclei in cells treated with VLS-1272, calculated in Harmony high-content analysis software. e , f Data presented as mean values with individual data points shown from n = 2 biological replicates. Source data are provided in the Source Data file.

Article Snippet: MDA-MB-231-Cas9-KIF2A or MDA-MB-231-Cas9-KIF2B cells were transfected twice with non-targeting sgRNA (Synthego scrambled sgRNA #1) or pooled sgRNAs targeting KIF18A (Synthego Gene Knockout Kit v2 sequences 5’- AAACUGACUUCUUCUUGUUU, 5’- AGCAGCUGGAUUUCAUAAAG, 5’- AUCAACAAUGUCUGUCACUG) using RNAiMAX (Thermo 13778-075), according to the manufacturer’s protocol.

Techniques: Immunofluorescence, Control, Generated, High Content Screening, Software, Labeling, Staining

Tumor volume measurements after administering vehicle or VLS-1272-SDD to ( a ) female SCID Beige mice bearing HCC15 tumor xenografts or ( b ) female Balb/c nude mice bearing OVCAR-3 tumor xenografts ( n = 10 mice per treatment group). Data presented as mean values -/+ SEM. p values of VLS-1272-treated groups compared to vehicle at Day 36 (HCC15) or Day 29 (OVCAR-3) are indicated and determined using one-way ANOVA with Dunnett’s multiple comparison test. Representative fluorescence images of KIF18A alone or together with α-tubulin and DAPI in tumors harvested from mice treated with vehicle or ( c ) 30 mg/kg VLS-1272 in HCC15 or ( e ) 60 mg/kg VLS-1272 in OVCAR-3. Scale bar = 10 µm ( c ) and scale bar = 5 µm ( e ). Quantification of KIF18A mislocalization measured as the ratio of KIF18A fluorescence colocalizing with α-tubulin over the amount of KIF18A colocalizing with DAPI in HCC15 ( d ) and OVCAR-3 ( f ) xenograft tumor sections. Data presented as mean values -/+ SEM from n = 5 mice per treatment group, ( d ) *** p = 0.00082 and ( f ) *** p = 0.00015 using two-tailed unpaired t test. Representative fluorescence micrographs and quantification of DAPI staining of tumors harvested from mice treated with vehicle or ( g , h ) 30 mg/kg VLS-1272 in HCC15 or ( i , j ) 60 mg/kg VLS-1272 in OVCAR-3. Scale bar = 5 µm ( g , i ). Data presented as mean values -/+ SEM from n = 5 mice per treatment group, ( h ) *** p = 0.00012 and ( j ) * p = 0.012 from two-tailed unpaired t -test. k Mitotic cell counts by pHH3 staining of tumor sections from excised OVCAR-3 xenografts. Data presented as mean -/+ SD from n = 3 mice per group. p values are indicated above the bars and determined using one-way ANOVA with Dunnett’s multiple comparison test. Source data are provided in the Source Data file.

Journal: Nature Communications

Article Title: Targeting chromosomally unstable tumors with a selective KIF18A inhibitor

doi: 10.1038/s41467-024-55300-z

Figure Lengend Snippet: Tumor volume measurements after administering vehicle or VLS-1272-SDD to ( a ) female SCID Beige mice bearing HCC15 tumor xenografts or ( b ) female Balb/c nude mice bearing OVCAR-3 tumor xenografts ( n = 10 mice per treatment group). Data presented as mean values -/+ SEM. p values of VLS-1272-treated groups compared to vehicle at Day 36 (HCC15) or Day 29 (OVCAR-3) are indicated and determined using one-way ANOVA with Dunnett’s multiple comparison test. Representative fluorescence images of KIF18A alone or together with α-tubulin and DAPI in tumors harvested from mice treated with vehicle or ( c ) 30 mg/kg VLS-1272 in HCC15 or ( e ) 60 mg/kg VLS-1272 in OVCAR-3. Scale bar = 10 µm ( c ) and scale bar = 5 µm ( e ). Quantification of KIF18A mislocalization measured as the ratio of KIF18A fluorescence colocalizing with α-tubulin over the amount of KIF18A colocalizing with DAPI in HCC15 ( d ) and OVCAR-3 ( f ) xenograft tumor sections. Data presented as mean values -/+ SEM from n = 5 mice per treatment group, ( d ) *** p = 0.00082 and ( f ) *** p = 0.00015 using two-tailed unpaired t test. Representative fluorescence micrographs and quantification of DAPI staining of tumors harvested from mice treated with vehicle or ( g , h ) 30 mg/kg VLS-1272 in HCC15 or ( i , j ) 60 mg/kg VLS-1272 in OVCAR-3. Scale bar = 5 µm ( g , i ). Data presented as mean values -/+ SEM from n = 5 mice per treatment group, ( h ) *** p = 0.00012 and ( j ) * p = 0.012 from two-tailed unpaired t -test. k Mitotic cell counts by pHH3 staining of tumor sections from excised OVCAR-3 xenografts. Data presented as mean -/+ SD from n = 3 mice per group. p values are indicated above the bars and determined using one-way ANOVA with Dunnett’s multiple comparison test. Source data are provided in the Source Data file.

Article Snippet: MDA-MB-231-Cas9-KIF2A or MDA-MB-231-Cas9-KIF2B cells were transfected twice with non-targeting sgRNA (Synthego scrambled sgRNA #1) or pooled sgRNAs targeting KIF18A (Synthego Gene Knockout Kit v2 sequences 5’- AAACUGACUUCUUCUUGUUU, 5’- AGCAGCUGGAUUUCAUAAAG, 5’- AUCAACAAUGUCUGUCACUG) using RNAiMAX (Thermo 13778-075), according to the manufacturer’s protocol.

Techniques: Comparison, Fluorescence, Two Tailed Test, Staining